Materials and Methods

Plant materials

Arabidopsis thaliana ecotype Landsberg erecta was used for DNA and RNA isolation. Seeds, leaves, flowers and stems were harvested from plants cultured in controlled environment chambers at 21^oC, 50% relative humidity, and constant light. Roots were obtained by culturing sterilized seeds in Gamborg's B-5 medium (Gamborg et al., 1968) in darkness at 25^oC for two weeks.

Isolation of cDNA clones

The cloning of FPG cDNAs from an A. thaliana flower cDNA library (Weigel et al, 1992) followed the techniques described previously (Murphy and Gao, 1998).

DNA gel blots

Total genomic DNA was isolated from the inflorescence and leaves of A. thaliana ecotype Landsberg erecta by the CTAB (cetyltriethylammonium bromide) extraction procedure (Ausubel et al, 1987) with modifications. Lysis buffer (200 mM Tris, pH 7.5, 50 mM EDTA, 2 M NaCl, 52 mM CTAB), extraction buffer (349 mM D-sorbitol, 99 mM Tris, pH 7.5, 4.5 mM EDTA, 15 mM Na-bisulfate) and 5% sarkosyl were mixed in proportions of 1:1:0.4 and heated to 65^oC to form a final extraction buffer. To this mixture the tissue, ground to a fine powder in liquid nitrogen, was added and extracted over 30 min with two periods of vortexing. After extraction with an equal volume of chloroform:1-octanol (24:1) for 20 min, the aqueous phase was separated by centrifugation and nucleic acids were precipitated with ethanol. The pellet was resuspended in TE buffer (10 mM Tris-Cl, 1 mM EDTA, pH 7.5), RNAase was added to a final concentration of 10 µg ml^-1, and the solution was heated at 37^oC for 30 min to remove RNA. After one more extraction with chloroform:1-octanol (24:1) and precipitation with ethanol, the purified DNA was dissolved in TE buffer. DNA (7 µg) was digested with Eco R I, Hind III, Xho 1 and Pst 1 restriction endonucleases, separated on a 0.8% agarose gel, and transferred to Immobilon Ny+ nylon filters (Millipore Corporation, Bedford, MA) as described by Sambrook et al. (1989).

Probes were synthesized by PCR. The 5'-terminal probe (common to both Atfpg-1 and Atfpg-2: Figure 1A, probe 1) was the same one used for clone selection. Forward and reverse primers for synthesizing clone-specific probes (Figure 1A, probes 2 and 3) were as follows (all 5' -> 3'): Atfpg-1, AAGAAGACGATGGAGATGGGG and TGGGATAACTGTTAGCTGCCC; Atfpg-2, ACCAAAACAGTATTCATTACC and GGTTTGAATCCCACATTTCAC.

All DNA fragments to be used as probes were purified by 0.8% agarose gel electrophoresis and labeled with [a³²P]dCTP (Random Primer DNA Labeling System, GIBCO BRL, Life Technologies, Gaithersburg, MD). Hybridization was carried out in a solution of 6x SSC, 5x Denhardt's (Sambrook et al., 1989), 0.5% SDS and 100 mg ml^-1 herring sperm DNA for 22 h at 65^oC. Following hybridization, filters were washed twice for 10 min each with 2x SSC, 0.1% SDS at room temperature and thereafter twice for 20 min each at 65^oC and autoradiographed. After autoradiography the filters were stripped by boiling in 0.1x SSC and 0.5% SDS to allow hybridization with a new probe. The same results were obtained from three independent preparations.

RT-PCR

Total RNA isolated from seeds, leaves, roots, flowers and stems as described above was analyzed by RT-PCR according to Gause and Adamovicz (1995). RNA samples (15 µg) were treated at 25^oC for 1 h with 10 µg of RNAase-free DNAase in 30 µl of solution containing 100 mM Na acetate, pH 5.2, 10 mM MgCl₂, and 23.4 units of pancreatic RNAase inhibitor; the RNA was then purified by chloroform extraction and ethanol precipitation. In separate reactions, cDNA synthesis was performed using 3.6 µg of RNA from each organ and each clone-specific Atfpg-1 or Atfpg-2 reverse primer described in the section on DNA gel blots (Figure 1B, primers R1 and R2, respectively). The cDNA mixtures were amplified by PCR using 5'-CTGCTTCTAGCCTCTTCAAAG-3' as forward primer (Figure 1B, primer F1) and the same reverse primers used for cDNA synthesis. cDNA synthesis and PCR was performed at least twice for RNA samples from each organ. The products were separated on 2% agarose gels, transferred to nylon filters, and hybridized to clone-specific probes (Figure 1A, probes 2 and 3) as described for DNA gel blots above. As a confirmation of the identity of RT-PCR products for Atfpg-2, fragments extracted from an agarose gel were cloned using the Topo-TA procedure of Invitrogen (La Jolla, CA), and the sequences of inserts of the appropriate sizes were determined.